Bacterial blight of Anthurium caused by Xanthomonas axonopodis pv. dieffenbachiae (Xad) is a destructive disease. The disease is spreaded with plant seedlings and no method for the pathogenic bacteria detection in our country. In this study, a PCR system for Xad detection with the specific primers Xad-F / XadR was developed. The results showed that Xad could be detected specifically by the system and the thresholds of PCR were 1 × 102 CFU / mL for Xad suspension and 0. 44 ng / μL for its DNA. The method developed in this study is effective to detect and identify the pathogen in Anthurium plants.

One hundred and seventysix symptomatic samples were collected from 18 provinces of China in 2009 and 2010, and analysed by using serological, polymerase chain reaction (PCR) and nucleotide sequencing methods. Serological detection results indicated that, Sweet potato feathery mottle virus (SPFMV) was the most commonly detected, being found in 56.3% of the samples, followed by Sweet potato virus G (SPVG) and Sweet potato caulimolike virus (SPCaLV), in 34.1% and 33.5% of the samples respectively. PCR and nucleotide sequencing showed that at least 8 viruses including SPFMV, SPVG, Sweet potato latent virus (SPLV), Sweet potato chlorotic fleck virus (SPCFV), Sweet potato chlorotic stunt virus (SPCSV), Cucumber mosaic virus (CMV), Sweet potato vein mosaic virus (SPVMV) and Sweet potato leaf curl virus (SPLCV), infected sweet potato in China. Besides, Sweet potato mild mottle virus (SPMMV) was not detected in the samples by serological and RTPCR methods. It was not sure if there were Sweet potato mild speckling virus (SPMSV), SPCaLV and C6 virus in the samples tested.

Carnation mottle virus (CarMV) is one of the important viruses infecting Carnation. In this study, three genes of p7, p9 and CP of CarMV were isolated from twelve different cultivars of Carnation by RT-PCR and their sequences of nucleotides and amino acids were analyzed. The results showed that the p7, p9 and CP genes had higher stability by sequence alignment. The identities of the nucleotide and the amino acid sequence of p7 gene were 98. 10% and 97. 81 % respectively. There were evident variations at the 11th and 14th of amino acid position of p7 gene. While the identities of the nucleotide and amino acid sequence of p9 gene were 98． 80% and 99. 13% respectively. There was clear variations at the 4th amino acid position of p9 gene. However, the identities of the nucleotide and amino acid sequence of CP gene were 97. 58% and 98. 43% respectively. There was correlative between the 164th and 331th amino acid. Those variations of positions of CP were dispersive. The results also showed that the mutations of p7 and p9 were main located at N-terminal parts which exposed to interact with host. Those variations of positions of CarMV might relate to vial variation and interaction between the virus and host.

Contamination of Fusarium deoxynivalenol (DON) mycotoxin in wheat grains is toxic to human and animals. To find out the content of DON accumulation in wheat grains and its relationship with Fusarium isolate, wheat cultivar, inoculating concentration of conidia and severity of wheat scab, nine isolates of
F． graminearum clade from different areas were inoculated on five wheat cultivars at the early flowering stage. A method of single flower drip inoculation was applied for each isolate with three concentrations of 106 , 105 and 104 conidia / mL, respectively. DON contents in wheat grains were measured using ELISA test. The results showed that the differences in DON content were mainly originated from the capability of producing mycotoxins by different isolates of F. graminearum. Under the same conditions, the DON content was much higher in wheat grains inoculated with the isolates 8003 and 4020 than that with the other seven isolates. While inoculated with the F. graminearum isolates that could produce higher DON mycotoxin, the resistant wheat cultivars displayed a certain extent to reduce the capacity of DON accumulation. The concentration of inoculated conidia had impact on the disease severity of wheat scab in the field and DON content in the grains and showed a positive correlation with either disease severity or DON content.

Totally 11 maize samples showing dwarf mosaic symptoms were collected from Chengde, Hebei
Province. The 3′-terminal 2. 1 kb genomic fragments were amplified with degenerate primers for Sugarcane
mosaic virus (SCMV) and Pennisetum mosaic virus (PenMV) and then sequenced. The Blast results showed
that eight samples were infected with PenMV. The cloned genome of these eight isolates were all 2 135 nucleotides
(nt) long, including partial NIb gene (985 nt), complete CP gene (909 nt) and the 3′-UTR (241 nt).
The CP gene and 3′- UTR shared nt identities of 89. 8% - 93. 4% and 95. 9% - 97. 9% , respectively, with
the corresponding PenMV sequences available in the GenBank. In the phylogenetic trees constructed with the
3′-terminal 2 135 nt sequence and CP gene, all the PenMV isolates were divided into two groups: Shanxi
group (SX) and Chengde group (CD). Recombination event was detected in the CP gene of isolate CD9.

Specific primers were designed according to the coat protein (CP) genes of Peanut stripe virus
Hongan isolate (PStV-Hongan), 2agene of Peanut stunt virus-mild strin (PSV-Mi) and Cucumber mosaic virus
peanut strain (CMV-CA), and cDNA fragments with length of 150 bp were obtained from the 5′ ends of
CP gene of PStV-Hongan, 3′ end of replicase 2agene of PSV-Mi and CMV-CA. The three cDNA fragments
were recombined into one chimeric cDNA by PCR amplification. The chimeric cDNA was then introduced into
the plant expressing vector pK7GW1WG2 in a way of inverted repeats by Gateway recombination Kits. The
identified plant-expression plasmid pK450 was introduced into Agrobacterium tumefaciens GV3101 by direct
transferring, and the target cDNA with inverted repeats was introduced into Nicotiana benthamiana. Transgenic
plants obtained by tissue culture and identified by PCR. The resistance assay indicated that about 66. 7% of
T1 transgenic plants were immune to PStV, 9% of the transgenic plants were recovered after CMV inoculation
and all the plants were susceptible to PSV. siRNA was found in all transgenic plants by Northern-blot test and
its amount decreased with the time after inoculation.

The mating types of 64 isolates of Phytophthora capsici collected from Yuexi, Qianshan, Hexian,Hefei, Shouxian, Huainan Funan and Bozhou of Anhui Province were investigated. The results showed that 58 isolates of A2 (accounting for 90. 6% of the total isolates) and 6 isolates of A1 (accounting for 9. 4% ) were detected. No isolates of A0 , A1 ,A2 and A1 A2 were discovered. A2 isolates were detected from all sampling regions, but A1 only in Hexian, Huainan, and Funan. It was suggested that the mating types of P. capsici isolatesin Anhui were not evenly distributed and A2 was the main mating type and absolutely preponderant in Anhui. HN8-Mrt and HN3-Mrt, the metalaxyl-resistant isolates were obtained from the wild-type isolate HN8 and HN3 after treatment with 10μg / mL metalaxyl, respectively. Further research indicated that mating type could not be changed by metalaxyl treatment and it could be stably inherited through single zoospore progeny of P.capsici.

 HSVd D15 is the only reported HSVd intramolecular recombinant. To examine it’s infectivity, recombinant plasmids contained 23 units of HSVd or HSVd D15 cDNAs were constructed and their infectivity were examined on the indicator plant Cucumis sativus L Suyo. As a result, HSVd was detected only from the plants inoculated with multiple units of HSVd cDNAs, but not from the plants inoculated with multiple units of HSVd D15 cDNAs. The infectivity of HSVd D15 should be further confirmed using improved inoculation method or by inoculating it onto viroidfree plums. Construction of the multiple units of HSVd D15 cDNAs provided foundation for the further study on infectivity of HSVd D15 on its original host plum.

The gene for resistance to powdery mildew, Pm21, derived from Dasypyrum viltosum and located on translocation chromosome 6VS. 6AL, was widely used in Chinese wheat programs. In recent years it was found that some wheat cultivars (lines) with the 6VS. 6AL translocation were susceptible to powdery mildew. In present study, a wheat 6VS. 6AL line R55 containing Pm21 was crossed with the wheat cultivars (line) Chuan-Nong 12 and R14. A complex segregation mode was observed in offspring of this cross. Three F7 families originated from the susceptible plants of the F6 lines of the cross, in which the 6VS. 6BL translocation chromosome was detected by using the molecular markers CINAU17-1086 and CINAU18-723 , was selected to
examine the different resistance expression of gene Pm21 to powdery mildew in wheat genetic background. A segregation ratio of 13 susceptible: 3 resistant was observed in the three families. In the F8 families derived from the F7 susceptible plants, 7 / 13 families exhibited susceptible and 6 / 13 families showed segregation, in which 2 / 13and 4 / 13 families fitted the ratios of 3 susceptible : 1 resistant and 13 susceptible : 3 resistant, respectively.
The results indicated that Pm21 was not expressed in some wheat lines, due to the presence of a dominant suppressor gene in the wheat cultivar (line) Chuan-Nong 12 or R14, which was designated as SuPm21. The interaction of alien genes with the genetic background of wheat genome is discussed in relation to wheat breeding program.

Arabidopsis BOI (Botrytis Susceptible 1 Interactor) encodes a RING protein with ubiquitin E3 ligase activity and plays important roles in defense against Botrytis cinerea and response to abiotic stress. In this study, the function of BOI in programmed cell death (PCD) was analyzed using knock-down and overexpression lines and the functions of the conserved RING and WRD domains of BOI protein in PCD was examined using constructs containing different domains of BOI protein. Down regulation of BOI led to reduced tolerance to oxidative stress and attenuated inhibitory effect on PCD induced by reactive oxygen species (ROS). Overexpression of BOI in stable transgenic lines and transient expression of BOI in tobacco leaves resulted in increased inhibitory effect on ROS-and α-picolinic acid (an inducer of PCD)-induced PCD. Further studies indicated that the RING domain but not the WRD domain in BOI protein was probably required for PCD inhibition.

The inhibitory effect of antagonistic Streptomyces on Verticillium dahliae Kleb. via enzymatic hydrolysis was studied. The pathogen mycelia were used as the sole carbon source, induced effect of V. dahliae on extracellular hydrolases synthesis by 4 tested Streptomyces in liquid cultures was examined; and interaction between Streptomyces and V. dahliae hypha via hydrolysis of aerial mycelium and microscopy were observed.The results showed that synthesis of extracellular chitinase, β-1,3-glucosidase, β-glucosidase and FP cellulase was induced by tested Streptomyces in the presence of V. dahliae. Optimal conditions for extracellular hydrolases fermentation of 4 Streptomyces were related to addition of 10 g·L - 1 fungi mycelium at 28℃ for 7 d.The activities of associated extracellular hydrolases were 70. 13 - 129. 05, 31. 04 - 37. 34, 6. 24 - 8. 75 and 1. 84 - 3. 35 U, respectively. Streptomyce crude enzyme solution induced disintegration of V. dahliaemycelia and hypha. All 4 Streptomyces were found capable of twining with V. dahliae hypha, leading to fungal cell
wall lysis.

An one-step dual RT-PCR method was developed for Southern rice black-streaked dwarf virus(SRBSDV) detection from host plants and insect vector white-backed planthopper (Sogatella furcifera Horvath,Hemiptera: Delphacidae), from which two cDNA fragments of the viral genome S5 and S10 were amplified
simultaneously. Two primer pairs, S5-F1 / S5-R2 (5′-ttacaactggagaagcattaacacg-3′ / 5′-atgaggtattgcgtaactgagcc-3′) and S10-oF / S10-oR (5′cgcgtcatctcaaactacag -3′ / 5′-tttgtcagcatctaaagcgc -3′), were selected from 40 primer pairs based on SRBSDV genome sequences, and amplified viral S5 ORF1 fragment (819 bp) and cp gene fragment ( 682 bp), respectively. Using total RNA extracts from infected plant leaf tissue or individual planthopper adult as templates, one step RT-PCR reaction in the conditions of annealing temperature of 53℃ with the final concentrations of 240 nmol / L S5-F1 / S5-R2 and 120 nmol / L S10-oF / S10-oR generated a similar yield of two amplicons in argrose electrophoresis analysis. Sequence analysis confirmed the correct
result of the amplification. Additionally, several commercal RNA extraction kits was proven to be fit for the template preparation, and the protocol for total RNA extraction from plant leaf tissue and individual planthopper was simplified by sample grinding direct in eppendorf tube. This method can be used for SRBSDV detection of dried or 70% alcochol soaked planthopper samples stored over one month in room temprature. Key words: Southern rice black-streaked dwarf virus; Sogatella furcifera Horvath

Potato virus Y (PVY) is the type member of the genus Potyvirus and infects several important solanaceous crops, including tobacco. PVY is one of the most widespread and economically destructive viruses. The P1 region of PVY had been used to determine the diversity, evolution and the homology based on the geographic location of the virus. The P1 region of PVY tobacco isolate from Qianxi in Guizhou Province was cloned and sequenced. Database searches and multiple sequence alignment showed subtle variation within the same strain, while apparent variation between O strain and the other three strains, N, NTN and N∶O. Moreover, variation in P1 region of Qianxi isolate derived from the gene mutation rather than the recombination among genomes. Phylogenic analysis revealed that the clustering only discriminated O strain from others. Consequently, sequence analysis in P1 region is unable to afford strain determination.

BD SMART technique and LD-PCR were applied to synthesize double strand cDNA(ds cDNA).The ds cDNA and pGADT7-Rec were transfered into competent yeast cell to construct yeast two-hybrid cDNA library of Curvularia lunata by homologous recombination method. The results showed that library capacitance was 2. 46 × 105 and transformation rate was 2. 13 × 105 / μg pGADT7-Rec. The plaque titer of the library was 2. 5 × 108 pfu / mL and the recombination frequency was 88. 24% . The length of inserted cDNA fragment was ranged from 0. 4 kb to 3 kb in average. This is the first time to use BD SMART technique to construct yeast two-hybrid cDNA library of C. lunata by homologous recombination.

The mycelium growth rate method was used to test the sensitivity to carbendazim (MBC) at distinctive concentrations in 136 isolates of Fusarium graminearum from 19 counties of 6 districts in Shaanxi Province in 2008. The distinctive MBC concentration was 4 mg / L for testing of resistance and sensitivity. The results showed that average 50% effective concentration (EC50 ) of 136 tested sensitive isolates were (0. 908 6 ± 0. 062 3) mg / L. All the isolates were sensitive to MBC. The fungicide of MBC could be continually applied wheat production in Shaanxi.

The efficient and accurate method of inoculating Exserohilum turcicum on maize is most important for studying the corn leaf blight. In this study, four approaches including spore suspension spraying, inoculation with grinding infected maize leaves, inoculation liquid inoculum into the leaf whorl and inoculation with inoculated sorghum seeds were compared with natural induction in fields during different growth stages of maize in the greenhouse and field. The results showed that disease incidence of all varieties tested were up to 100% by inoculating with inoculated sorghum seeds during the booting stage (11 to 12 leaf stages). This method will not only guarantee the enough pathogen inocula but also be easy to use, and could be an effective way for disease resistance identification in field and greenhouse. 

An antagonistic Streptomyces strain B28, isolated from the soil collected in Tianmu mountain of Zhejiang Province, was identified as Streptomyces diastatochromogenes by morphological , physiological & biochemical characteristics and 16S rDNA sequence alignment. Antagonistic study indicated that its secondary metabolite toyocamycin had an antifungal activity on the mycelial growth of seven species of plant pathogenic fungi. The results showed that toyocamycin possessed marked inhibitory activity against Rhizoctonia solani and the EC50 value was 0. 58 μg / mL. The effective of toyocamycin against Botrytis cinerea and Fusarium oxysporum f. sp. cucumerinum was much higher than that against Colletotrichum gloeosporioides, the EC50 value of
toyocamycin in inhibiting B. cinerea, F. oxysporum and C. gloeosporioides were 13. 65 μg / mL, 12. 33 μg / mL, and 30. 15 μg / mL respectively.

Corynespora leaf spot of eggplant was reported in China recent years. In this study, the damage and typical symptoms of this disease were reported. The pathogen caused Corynespore leaf spot was identified by pathogenicity testing, morphological characteristics and molecular identification. The pathogenicity of the isolates was significantly higher on eggplant than that on cucumber. The morphological identification showed that conidia of the pathogen were cylindrical and thin in shape, whereas were cylindrical or oblavate in shape on cucumber. The rDNAITS region of the pathogen was amplified by PCR and then sequenced. Based on the morphological characteristics, pathogenicity testing and rDNA molecular analysis, it was confirmed that the pathogen of Corynespora leaf spot in Shandong and Liaoning was Corynespora cassiicola .

A new anthracnose disease was found on immature fruits of chili pepper (Cayenne pepper cv. Hongxiu 2003, line fruited) in Zhijiang county, Hunan, in August of 2009. Typical lesion was long oval in shape with tawny powder at the center, concentric pink dot periphery and outer water soaked zone. All 8 isolates(HNZJ001HNZJ008) showed the colonies white at the early stage, then pink, finally dark with obvious grey black concentric rings. No seta was observed on acervuli. Conidia were singlecelled, 15. 8 μm×4. 1 μm in size, with a subacute end and 2-7 oil droplets in each cell. After needle prick inoculation with spore suspension,HNZJ001 caused lesions on both mature and immature pepper fruits while the control Collectotrichum gloeosporioides strain LSQ1 did not infect immature ones. PCR product was sequenced .After BLAST analysis, rDNA ITS (internal transcribed spacer) of HNZJ001 revealed 100% nucleotide identity to that of C. acutatum (sexual stage Glomerella acutata). Phylogenetic analysis showed a high bootstrap value of 100%. It comes into conclusion that the pathogen causing anthracnose of immature pepper in Zhijiang be identified as C. acutatum. This is the first report of C. acutatum on chili pepper in China.

RTPCR, immunocapture RTPCR and SYBR Green Ⅰ realtime RTPCR approaches were developed for detecting IYSV from infected leaves of tobacco (Nicotiana tabacium) plant. Comparative study on detective sensitivity of these PCRbased approaches was also carried out. In contrast to the double antibody sandwich (DAS)ELISA that could only detect the virus from 1 mg of infected leaves, the developed PCR approaches showed more than 100 times higher sensitivity. In particular, SYBR Green Ⅰ realtime RTPCR had the highest sensitivity and could detect IYSV from as low as 0.4 μg of the infected leaves, while RTPCR detected the virus only from 40 μg of the infected leaves and ICRTPCR showed four times more sensitive than that of RTPCR. Since the relative low sensitivity of DASELISA, it is suggested that PCR approaches should be performed to avoid the possible omission, once the ratio of OD405 between sample and control is about 2.0 during the primary detection by ELISA.

In those of Syringa oblata plants showing symptoms of leaf roll, chlorotic, a great quantity of structures resembling phytoplasmas were observed in small pieces of phloem sieve elements by Electron microscopy. Nested PCR using a combination of phytoplasmaspecific universal primer pairs (P1/P7 R16F2n/R16R2) amplified 16S rDNA with the expected size (1.2 kb) from all samples of symptomatic S.oblata plants. On the basis of sequencing, phylogenetic analysis and nucleotide alignments to PCR products, a 1 246 bp fragment was obtained that clustered together with the members of ‘Candidatus Phytoplasma asteris’ and shared a 98% similarity. Group specific primer pairs R16(Ⅰ)F1/R16(Ⅰ)R1 and R16(Ⅴ)F1/R16(Ⅴ) proved that this disease was caused by unmixed infection. Similarity coefficient and RFLP analysis indicated that it was belonged to phytoplasmas members of 16Sr IB. This is the first time to report group ‘Candidatus Phytoplasma asteris’ infecting S.oblata plants in China.

The cDNA of chitinase Tvchi gene was isolated from Trichoderma viride by using RTPCR.Sequence analysis showed that the ORF of Tvchi was 1 293 bp in size and encoding 430 amino acid residues . The Blast showed that the Tvchi had high nucleotide sequences homology with other Trichoderma spp. Tvchi was further ligated with pET28a vector and then transformed into Escherichia coli BL21 (DE3). SDSPAGE and Westernblot results revealed that Tvchi was expressed a 47 kD  recombinant protein in E.coli. The imidazole at the concentration of 100 mmol·L-1 could efficiently elute higher and purer purified protein. Affinity purification by NiNTA, high quality fusion protein was obtained．The optimum temperature and pH for reaction of the enzyme were 37℃ and 6.8, respectively.Analysis of antibacterial activity revealed that the expression products displayed better inhibiting ability on Fusarium graminearum Schw, Rhizotonia cerealis vander Hoeven and Gaeumannomyces graminis var. tritici Walker. The result applies a base for further research on chitinase Tvchi gene from T. viride.

In order to study the properties and functions of chitinases from Talaromyces flavus, the fulllength DNA of a chitinase gene, tfchi1 was amplified by RTPCR, 3′ RACE and 5′ TAILPCR. It has 2 561 bp in length with six introns, and contains an 1194bp long open reading frame (ORF) encoding a protein of 397 amino acid residues with the calculated molecular mass of 43.47 kDa. The protein, Tfchi1 belongs to lycoside hydrolase family No.18. The plasmid pPIC9K/tfchi1 was constructed and transformed into Pichia pastoris and a recombinant strain with efficient expression of chitinase, GSTFCHI19 was obtained. Tfchi1 was secreted successfully with the yield reaching 32.29 U·mL-1 by the 7day methanol induction; it had a molecular weight of about 44.0 kDa according to the SDSPAGE detection, which was close to the predicted molecular mass. The optimal pH and temperature of Tfchi1 were 5.5 and 35℃ respectively. Tfchi1 was quite stable at pH ranging from 6 to 8 and its activity was significantly inhibited by Zn2+, Cu2+. The results of antifungal activity assay showed that Tfchi1 could inhibit the mycelium growth and spore germination of sensitive plant pathogenic fungi evidently, and the Tfchi1 produced by T. flavus was considered to have potential application in exploitation of chitin resources and in biological control of plant fungal diseases.

Proteomic approaches using twodimensional electrophoresis (2DE) were conducted to identify the differentially expressed proteins in rice leaves in response to methyl jasmonate (MeJA). Proteins were extracted from rice leaves at 8 h and 12 h after treatment with 0.1 mmol/L MeJA and then fractionated using PEG 4000mediated prefractionation technique before separation by 2DE. In total, twentyone proteins resolved in the 2DE gels were upregulated or downregulated in the inoculated rice leaves compared with the controls. At 8 h after treatment with MeJA, 5 and 8 differentially expressed proteins in CO39 and C101LAC were identified, respectively. Among them, U5 protein spot was specifically induced in both two rice cultivars. At 12 h, changes of 6 proteins and 5 proteins were detected in CO39 and in C101LAC, respectively. These differentially displayed proteins were successfully identified by ingel digestion, MALDITOF/TOF analysis and database searching. The protein spot U5 was identified as endo1,31,4betaDglucanase. According to protein annotations from GO database and UniProtKB database, the 21 MeJAresponsive proteins were classified into eight categories based on their putative function reported: 1) plant defense response, 2) aminoacid biosynthesis, 3) signal transduction, 4) photosynthesis, 5) photorespiratory, 6) carbohydrate metabolism, 7) protein biosynthesis and proteolysis and 8) metabolic process.

To detect the distribution of mitochondrial haplotypes of Phytophthora infestans in Qinghai Province, 70 isolates of Phytophthora infestans collected from different areas in 2006-2007 were identified and analyzed. The results showed that the typeⅡa was the most important, accounting for 94.3%, and the rest 57% belong to the typeⅡb. The typeⅡb strains were all isolated from tomato plants. The results showed that the typeⅡa was the major potato Phytophthora infestans strain in Qinghai, and its mitochondrial haplotype was simplistic.

To reveal the functions of OsBTF3 gene in rice in response to infection by Xanthomonas oryzae pvs. oryzae and oryzicola, the responses and expression of defense genes of transgenic rice with overexpressed or RNAisilenced OsBTF3 were comparably analyzed. The results showed that more susceptible phenotypes were found either in transgenic rice with overexpressed or RNAisilenced OsBTF3 than the control of wildtype plants. In addition, the changes in expression of selected defense genes induced by Xoo were observed both in the transgenic rice lines and the control plants. Therefore, over or downexpression of OsBTF3 regulates the disease resistance/susceptibility in rice, which is independent on SA or JAmediated signaling pathways.

Two pathovars, Xanthomonas oryzae pv. oryzae (Xoo) and X. oryzae pv. oryzicola (Xoc), cause bacterial blight (BB) and bacterial leaf streak (BLS) of rice (Oryza sativa), respectively. In order to realize mutation in interesting genes of two pathovars accurately and efficiently, an insertion mutagenesis system was successfully established here with pK18mobGⅡ vector. The hrcV and hrpF mutants both of Xoo and Xoc were generated by allelic exchange between homologous fragments of the hrcV and hrpF genes, respectively. The pK18mobGⅡ, harboring different homologous fragments of hrcV or hrpF, was integrated into hrcV and hrpF gene loci. These events were verified by PCR amplification and Southern blot. 200 400 bp homologous fragments for targeted genes by pK18mobGⅡ would lead to the higher mutation efficiency. Moreover, transformation efficiency of the recombined DNA plasmids to the recipient strain by conjugation was five to hundred times of that by electroporation. Virulence assay demonstrated that the insertion mutagenesis in hrcV gene led the complete loss of pathogenecity in host rice. Therefore, this mutagenesis system would facilitate the understanding of pathogenicityassociated genes when Xanthomonas oryzae interact with rice.

The epidemic components (latent period, infection probability, lesion cumulative sporulation and lesion dailyexpansion area) and the parasitic fitness of 12 isolates of wheat powdery mildew (Blumeria graminis f．sp．tritici) with different sensitivity to temperature were tested by detached leaf segment method under 18℃ and 22℃ temperature conditions, respectively. The results showed that there were significant differences among epidemic components of the different isolates at the two temperature conditions, and the correlation between lesion cumulative sporulation and lesion dailyexpanded area was the highest. The parasitic fitness of every tested isolates at 22℃ was lower than that at 18℃. The parasitic fitness of the isolates with low sensitivity to temperature was totally higher than that of moderately sensitive and highly sensitive isolates at the two temperature conditions. This tendency was more obvious at the higher temperature.

Using electron microscopy and ELISA, Tomato zonate spot virus (TZSV) isolates were detected from fluecured tobacco in 11 counties and cities of Yunnan. With primers from conserved regions, the nucleocapsid (N) gene sequences of 31 naturally occurring TZSV isolates from fluecured tobacco were amplified by RTPCR. Sequence analysis showed a high level of sequence conservation (94.9%~98%) among the N genes of the tobacco isolates. However, cluster dendrogram showed distinct differences were present in Yunnan TZSV isolates from different area. Amino acid sequence analysis showed that two amino acid residues were considered to be area specific in Wenshan isolates and Xichou isolates.

To explore the potential application of unmanned aerial vehicle (UAV) on monitoring wheat stripe rust caused by Puccinia striiformis f. sp. tritici, the image of wheat plots was obtained at the UVA platform. Correlation analyses between disease indexes of stripe rust and four kinds of the reflectance, i.e. the canopy reflectance and the reflectances in red, green and blue band extracted from the image, were conducted. The estimation models between disease indexes and each kind of the reflectance were built using linear regression method. The results showed that there was an extremely significant difference between the reflectances of diseased wheat plots and healthy plots. Disease indexes had positive correlation with the four kinds of the reflectances. Disease index was best fitted by the model with the reflectance in red band as independent variable. The diseased and the healthy areas in the UAV image were distinguished by using ISODATA method. The results indicated that UVAbased monitoring of wheat stripe rust was feasible and image analysis technologies could play a potential role in the monitoring process.

The fungicide resistance of anthracnose in Camellia oleifera nurseries was investigated in Liuyang, Changning, and other regions in Hunan Province. The Colletotrichum gloeosporioides strains from the former two regions were highly resistant to carbendazim. After subcultured for 10 generations on fungicidefree medium, the resistant strains grew well on the medium containing carbendazim 450 μg/mL and suggesting that its resistance was stable. The βtubulin genes from the resistant and susceptible strains were cloned and sequenced.  The coding region was 1 344 bp nucleotides and predicted to encode a protein with 447 amino acids. Comparison of the βtubulin amino acid sequences between resistant and susceptible strains of Colletotrichum gloeosporioides revealed that a mutation leading to an amino acid substitution at the position 198 from glutamic acid in the susceptible strain to alanine in the resistant strain. Finally, the main morphological characteristics of C.gloeosporioides were descripted，but it could not be used to determine the resistance to carbendazim.

Witches’ broom is one of the most serious diseases in Paulownia production. Morphological changes of the witches’ broom seedlings of Paulownia tomentosa treated with methyl methanesulphonate and SSR analysis were investigated in order to further study the relation between the disease and DNA changes. The results indicated that the diseased seedlings treated with optimal concentration of MMS might turn into the ones without symptom morphologically, but there still existed the phytoplasma in the seedlings treated with 20mg·L-1 MMS. Not only might MMS of which the concentrations were more than 80 mg·L-1 eliminates the phytoplasma from the seedlings, but also inhibits the seedling growth. DNA base sequences of the healthy, diseased and the diseasedtreated with 20 and 100 mg·L-1 MMS seedlings were the same at SSR level.

Four cereal cyst nematode (CCN) populations of wheat were collected from Boai, Qingfeng, Anyang counties in Henan Province and Handan county in Hebei Province in 2009. The cyst of Boai population had distinct underbridge in the vulval cone area, but other three tested populations had not. The main morphological characteristics and measurements of the cyst and the second juvenile of Boai population conformed to Heterodera filipjevi, and that of the populations from Qingfeng, Anyang and Handan conformed to H. avenae. The result of ITS sequence analysis and alignment indicated that Boai population and related species H. filipjevi from America and Italy were clustered in the same group with close relationship by MP of MEGA 4，and the three populations from Qingfeng, Anyang, Handan and the related species H. avenae from Tongzhou and Zhengzhou were clustered in the same group. Based on the morphological and molecular characteristics, the Boai population was identified as H. filipjevi and the other three populations were identified as H. avenae.

According to cultural characteristics on potato dextrose agar (PDA), there were five different culture types (A to E) of Verticillium dahliae isolates from 84 counties of 12 provinces in China. Among them, Type B was the dominant group accounted for 72.9%, which produced abundant microslerotia on PDA. The isolates from Yangtze River region showed higher variation than those from Yellow River and those from Xinjiang varied slightly. Based on the results from the pathogenicity tests and ISSR fingerprint, 167 isolates were clustered into three groups which showed high, moderate and low virulence to cotton, respectively. There was a close corelation between virulence and the ISSR fingerprint. Isolates with moderate virulence were dominant in China. High virulent isolates mainly distributed in Hebei, Henan and Hubei, whereas low virulent isolates mainly distributed in Xinjiang and Jiangsu.

A new disease on globe artichoke (Cynara scolymus  L.) was observed in commercial fields in Changde, Hunan Province, China. Typical symptoms were wilting and necrosis from the outermost leaves, dark brown discoloration of the vascular tissue and pith of main stem. Eventually, the plants wilted and died. Manual weeding and cuttings often led to the development of typical soft rot during propagation. To investigate the causal agent of the disease, isolations were made from rotted stems of field artichoke plants on nutrient agar (NA). Bacteria consistently isolated from the diseased tissues formed greywhite, glossy, convex, translucent, and round colonies on NA. The bacterial cells were gram negative rods with 2 to 8 peritrichous flagella and rounded ends under the microscope. In artificial inoculation test, these isolates could also cause stem rot of Chinese cabbage, pepper, lettuce and artichoke, and slice rot of carrot, tomato and potato within 48 h at 28℃. The results demonstrated that these isolates are causative agent of soft-rot disease. PCR amplification was carried out by utilizing universal 16S rDNA primer pair 16SF/16SR and  pel gene primers Y1/Y2. The 16S rDNA and pel gene sequences of isolate HNXDT002 (GenBank accessions JF721958 and JF721960, respectively) had 99% and 93% nucleotide identity with strains of  Pectobacterium carotovorum  subsp.  carotovorum (GenBank accessions U80197 and CP001657, respectively).It came to the conclusion that the causal agent of softrot  disease on artichoke belonged to Pectobacterium carotovorum  subsp. carotovorum.

The actinomyces strain YSSPG3 suppressing  Arthrinium phaeospermum  was isolated from rhizosphere of healthy hybrid bamboo in Sichuan, and its fermentation filtrate showed inhibitory effect to many fungi and bacteria. Based on the study of its morphological, physiological and biochemical characteristics, together with sequencing of 16S rDNA genes and phylogenetic analysis, strain YSSPG3 was identified as  Streptomyces purpeofuscus . The antifungal protein (AMP) with a molecular mass of 5 075.619 Da was purified by the methods of ammonium sulfate precipitating and column chromatography. The isoelectric point (pI) of AMP was 6.77 and lacked the activity of hydrolytic enzyme such as chitinase and glucanase. The inhibitory activity of the antifungal protein decreased distinctly at the higher temperature (≥60℃), in the condition of acidity (pH＜7) and a long ultraviolet radiation time (≥12 h), but was tolerant of proteinase K, trypsin and chloroform. The N-terminal sequence between the antifungal protein and a kind of chitin-binding protein AFP1 from  S. tendae  Tü901 was of higher homology in 81.00%。

The paper aimed to express the α-tubulins of  Fusarium graminearum  in  Escherichia coli  and purify them. The α-tubulin genes were amplified from  F. graminearum  cDNA and cloned to the vector pET30a⁺, then transformed into the host Rossatta（DE3）pLysS. After the positive clones were screened by the colony PCR and double digestion, the induced fusion proteins were obtained and verified by SDS PAGE and Western blot. The positive clones which could express more fusion protein were screened, however, the fusion proteins formed were mainly inclusion bodies. The molecular weight of fusion proteins were confirmed to be 52.1 and 55.9 kD by SDS PAGE, which also showed specific activity to anti-6×His monoclonal antibody. After  washing  inclusion bodies with the buffer containing 2 and 3 mol/L urea, the purity of fusion protein would increase . The soluble fusion protein was obtained by dialysis to binding buffer and then α tubulins were  purified  by HisTrap ^TM  HP Columns. The purified tubulins can be used in the studies of new fungicide screening that target tubulin  in vitro

Tolerance comparisons to low temperature were performed between different strains of blast fungi isolated from rice fields of Northern and Southern China. Statistical analysis indicated that there existed a remarkable difference in low temperature tolerance between northern and southern isolates. More than 95% strains from northeastern area can tolerate low temperature of -15℃ at least for one week. However, only 65% strains from Southern China can survive. Based on this, several strains sensitive to low temperature were selected and subjected to the critical lethal low temperature for successive generations. The results showed that low-temperature tolerability of eight strains were significantly improved through 55 cycles of repeated freeze-thaw treatment. Culture characteristics and resistance to antifungal chemicals of some strains were also changed. Eleven secretory proteins from the enhanced tolerant strains were identified by two dimensional gel electrophoresis and mass spectrometry analysis. This study provides important information for effective strategy in the prevention and control of rice fungal blast.

The helper component-proteinase (HC-Pro) encoded by potyviruses is the first identified RNA silencing suppressor. In the study, three mutants of  Potato virus A (PVA) HC-Pro were obtained via site-directed mutagenesis and analyzed for their activities on RNA silencing via agroinfiltration. Compared with that of wild type HC-Pro, the treatment with deletion mutants of amino acids Phe⁶ and Asn¹¹  resulted in reduced green fluorescence, while treatment with substitution mutant of Ile²⁵⁰-Gly²⁵¹-Asn²⁵²  motif to Asp²⁵⁰Glu²⁵¹Asn²⁵²  resulted in no fluorescence. These results suggested that amino acids Phe⁶, Asn¹¹  and motif Ile²⁵⁰-Gly²⁵¹-Asn²⁵²  are involved in modulating the RNA silencing suppression activity of HC-Pro.

A new winter wheat variety LJ9821, which was obtained by introducing the total DNA of sorghum into commercial wheat variety Tao157, possesses more excellent characters such as higher yield and resistance to stripe rust. The genetic resistance character of wheat variety LJ9821 was studied. The results suggested that LJ9821 possessed unknown resistant genes or gene combination deduced from the seedling resistance genes using differential isolates of Puccinia striiformis. The resistance to CYR29 and CYR33 was controlled by one dominant gene in seedling stage at greenhouse respectively. Combined with the identified resistance and its spectrum to Puccinia striiformis, two dominant genes which resistant to CYR29 and CYR33 were different. One resistant gene to CYR29 came from wheat variety T157. It was worth using in wheat production and breeding in future in Gansu Province.